Skip to content
Plant Biology

Plant Biology

Genetics

  • Home
  • Blog
  • Antibodies
  • Assay Kits
  • Biology Cells
  • cDNA
  • Elisa Kits
  • Enzymes
  • DNA Testing
  • DNA Templates
  • Clia Kits
  • Culture Cells
  • Devices
  • DNA
  • Equipments
  • Bayesian approach for analysis of time-to-event data in plant biology.
  • Functional characterisation of metal(loid) processes in planta through the integration of synchrotron techniques and plant molecular biology.
  • Test of Arabidopsis Space Transcriptome: A Discovery Environment to Explore Multiple Plant Biology Spaceflight Experiments.
  • western blot protocol pdf
  • dna
  • western blot reference
  • western blot steps
  • western blot test
  • western blot test lyme
  • western blot test herpes
  • western blot test lyme disease
  • Test of Arabidopsis Space Transcriptome: A Discovery Environment to Explore Multiple Plant Biology Spaceflight Experiments.
  • western blot wb
  • Bayesian approach for analysis of time-to-event data in plant biology.
  • western blotting protocol
  • cdna 260/280
  • cdna amd
  • cdna gpu
  • cdna lab
  • cdna nyc
  • cdna orf
  • pcr
  • pcr kits price
  • cdna synthesis
  • pcr test for coronavirus
  • cdna vs dna
  • pcr test for covid 19
  • pcram
  • Genetic differences between benign phyllodes tumors and fibroadenomas revealed through targeted next generation sequencing
  • The role of SAMM50 in non-alcoholic fatty liver disease: from genetics to mechanisms
  • PHACTR1 genetic variability is not critical in small vessel ischemic disease patients and PcomA recruitment in C57BL/6J mice
  • Functional characterisation of metal(loid) processes in planta through the integration of synchrotron techniques and plant molecular biology.
  • Test of Arabidopsis Space Transcriptome: A Discovery Environment to Explore Multiple Plant Biology Spaceflight Experiments.
  • Bayesian approach for analysis of time-to-event data in plant biology.
  • Contact Us

serums.com

Viral infections in humans and mice with genetic deficiencies of the type I IFN response pathway

March 19, 2021March 18, 2021 by Erica Adams
Viral infections in humans and mice with genetic deficiencies of the type I IFN response pathway
Type I interferons (IFNs) are so-named as a result of they intrude with viral an infection in vertebrate cells. The research of mobile responses to type I IFNs led to the discovery of the JAK-STAT signaling pathway, which additionally governs the response to different cytokine households. We overview right here the end result of viral infections in mice and humans with engineered and inborn deficiencies, respectively, of (i) IFNAR1 or IFNAR2, selectively disrupting responses to type I IFNs, (ii) STAT1, STAT2, and IRF9, additionally impairing mobile responses to type II (for STAT1) and/or III (for STAT1, STAT2, IRF9) IFNs, and (iii) JAK1 and TYK2, additionally impairing mobile responses to cytokines aside from IFNs.
An image is rising of higher redundancy of human type I IFNs for protecting immunity to viruses in pure situations than was initially anticipated. Mouse type I IFNs are important for defense towards a broad vary of viruses in experimental situations. These findings counsel that numerous type I IFN-independent mechanisms of human cell-intrinsic immunity to viruses have but to be found.

Genetic mechanisms and correlational choice construction trait variation in a coral snake mimic

Covariation amongst traits shapes each phenotypic evolution and ecological interactions throughout area and time. However, rampant geographical variation in the energy and route of such correlations could be notably tough to clarify via generalized mechanisms. By integrating inhabitants genomics, surveys of pure historical past collections and spatially express analyses, we examined a number of drivers of trait correlations in a coral snake mimic that reveals exceptional polymorphism in mimetic and non-mimetic color traits.
We discovered that though such traits co-occur extensively throughout area, correlations have been greatest defined by a combination of genetic structure and correlational choice, quite than by any single mechanism. Our findings counsel that spatially complicated trait distributions could also be pushed extra by the easy interplay between a number of processes than by complicated variation in one mechanism alone. These interactions are notably vital in mimicry techniques, which continuously generate hanging geographical variation and genetic correlations amongst color sample traits.

Evaluating the function of GSTP1 genetic polymorphism (rs1695, 313A>G) as a predictor in cyclophosphamide-induced toxicities

The affiliation between Glutathione S-transferase Pi 1(GSTP1) genetic polymorphism (rs1695, 313A>G) and cyclophosphamide-induced toxicities has been broadly investigated in earlier research, nonetheless, the outcomes have been inconsistent. This research was carried out to additional elucidate the affiliation.A complete search was performed in PubMed, Embase, Web of Science, China National Knowledge Infrastructure, and Wan Fang database as much as January 5, 2020. Risk ratios (RRs) and 95% confidence intervals (95% CIs) have been used to estimate the affiliation between GSTP1 rs1695 polymorphism and cyclophosphamide-induced hemotoxicity, gastrointestinal toxicity, an infection, and neurotoxicity.A complete of 13 research have been finally included.
Compared with the GSTP1 rs1695 AA genotype carriers, sufferers with AG and GG genotypes had an elevated threat of cyclophosphamide-induced gastrointestinal toxicity (RR, 1.61; 95% CI, 1.18-2.19; P = .003) and an infection (RR, 1.57; 95% CI, 1.00-2.48; P = .05) in the total inhabitants. In the subgroup analyses, there have been vital associations between GSTP1 rs1695 polymorphism and the threat of cyclophosphamide-induced myelosuppression (RR, 2.10; 95% CI, 1.60-2.76; P < .00001), gastrointestinal toxicity (RR, 1.77; 95%CI, 1.25-2.53; P = .001), and an infection (RR, 2.01; 95% CI, 1.14-3.54; P = .02) in systemic lupus erythematosus (SLE) or lupus nephritis syndrome sufferers, however not in most cancers sufferers.
Our outcomes confirmed a necessary function for the GSTP1 rs1695 polymorphism in the prediction of cyclophosphamide-induced myelosuppression, gastrointestinal toxicity, and an infection in SLE or lupus nephritis syndrome sufferers. More research are essential to validate our findings in the future.
Viral infections in humans and mice with genetic deficiencies of the type I IFN response pathway

Genetic relationships amongst rhizopine-producing Rhizobium strains

Chromosomal and symbiosis-related genotypes of rhizopine-producing and non-producing isolates of Rhizobium meliloti and Rhizobium leguminosarum have been examined by multilocus enzyme electrophoresis and RFLP. The distribution of rhizopine manufacturing in each species was discovered to be unbiased of host genotype. Conversely, rhizopine manufacturing was related with specific symbiotic plasmid varieties.
This affiliation could clarify the noticed distribution of rhizopine manufacturing in R. leguminosarum and R. meliloti. Rhizopine synthesis (mos) genes confirmed higher sequence divergence than rhizopine catabolism (moc) genes in each R. meliloti and R. leguminosarum. Furthermore, mos and moc genes have been much less divergent in R. leguminosarum than R. meliloti, suggesting a newer evolution in the former species.

The Polymorphism Analyses of Short Tandem Repeats as a Basis for Understanding the Genetic Characteristics of the Guanzhong Han Population

The brief tandem repeat (STR) loci are polymorphic markers in the mixed DNA index system (CODIS) and non-CODIS STR loci. Due to the extremely polymorphic attribute of STR loci, they’re fashionable and broadly used in forensic DNA typing laboratories. In this research, 22 STR loci (1 CODIS, 21 non-CODIS STR loci) and an Amelogenin locus have been genotyped and analyzed in 590 unrelated people of the Guanzhong Han inhabitants. None of the 22 STR loci deviated from the Hardy-Weinberg equilibrium, and all the loci have been in the linkage equilibrium state.
We noticed 247 alleles, and the corresponding allelic frequencies ranged from 0.0008 to 0.3695 in the Guanzhong Han inhabitants. The mixed energy of discrimination and the cumulative exclusion likelihood was 0.999 999 999 999 999 999 999 999 999 346 36 and 0.999 999 999 709 74, respectively. The outcomes together with Nei’s D A genetic distance, multidimensional scaling evaluation, and principal part evaluation confirmed that the Guanzhong Han inhabitants has nearer genetic affinities with Northern Han, Chengdu Han, and Xinjiang Hui teams from China primarily based on allelic frequencies of 15 overlapped STR loci from Guanzhong Han and 13 reference teams.

SCHIP1 antibody

10R-7161 Fitzgerald 100 ul
EUR 726
Description: Mouse monoclonal SCHIP1 antibody

SCHIP1 antibody

10R-7162 Fitzgerald 100 ul
EUR 691
Description: Mouse monoclonal SCHIP1 antibody

SCHIP1 antibody

10R-7163 Fitzgerald 100 ul
EUR 691
Description: Mouse monoclonal SCHIP1 antibody

SCHIP1 antibody

10R-7165 Fitzgerald 100 ul
EUR 691
Description: Mouse monoclonal SCHIP1 antibody

SCHIP1 siRNA

20-abx932593 Abbexa
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SCHIP1 siRNA

20-abx932594 Abbexa
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-SCHIP1

YF-PA18665 Abfrontier 50 ug
EUR 363
Description: Mouse polyclonal to SCHIP1

HEK-293T Telomerase Over-Expressing Cell Pellet

abx069991-1Pellet Abbexa 1 Pellet
EUR 398
  • Shipped within 1-3 working days.

anti- SCHIP1 antibody

FNab07634 FN Test 100µg
EUR 548.75
  • Immunogen: schwannomin interacting protein 1
  • Uniprot ID: Q9P0W5
  • Gene ID: 29970
  • Research Area: Neuroscience
Description: Antibody raised against SCHIP1

SCHIP1 Rabbit pAb

A17420-100ul Abclonal 100 ul Ask for price

SCHIP1 Rabbit pAb

A17420-200ul Abclonal 200 ul Ask for price

SCHIP1 Rabbit pAb

A17420-20ul Abclonal 20 ul Ask for price

SCHIP1 Rabbit pAb

A17420-50ul Abclonal 50 ul
EUR 384

SCHIP1 cloning plasmid

CSB-CL878951HU-10ug Cusabio 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 735
  • Sequence: atggtacatcaggataactgctcgtatcaggcacagaaaaatgagagagagtctatcagacagaagttggcacttggaagcttctttgatgatggcccaggaatttataccagctgtagcaaaagtgggaagccaagcctttcctcccgactgcagagtgggatgaacttgcagat
  • Show more
Description: A cloning plasmid for the SCHIP1 gene.

Anti-SCHIP1 antibody

PAab07634 Lifescience Market 100 ug
EUR 386

Anti-SCHIP1 antibody

STJ119541 St John's Laboratory 50 µl
EUR 393
Description: NA

Bluing Reagent

BRT030 ScyTek Laboratories 30 ml
EUR 60

Bluing Reagent

BRT125 ScyTek Laboratories 125 ml
EUR 63

Bluing Reagent

BRT3800 ScyTek Laboratories 1 Gal.
EUR 184

Bluing Reagent

BRT500 ScyTek Laboratories 500 ml
EUR 76

Bluing Reagent

BRT999 ScyTek Laboratories 1000 ml
EUR 88

Beaucage reagent

HY-100951 MedChemExpress 10mM/1mL
EUR 126

BOP reagent

A7015-100000 ApexBio 100 g
EUR 200
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

BOP reagent

A7015-25000 ApexBio 25 g
EUR 113
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

BOP reagent

5-02141 CHI Scientific 25g Ask for price

BOP reagent

5-02142 CHI Scientific 100g Ask for price

Chymase reagent

30C-CP1129 Fitzgerald 5 units
EUR 2185
Description: Purified native Human Chymase reagent

Traut's Reagent

2330-1000 Biovision
EUR 349

Traut's Reagent

2330-500 Biovision
EUR 207

MTS Reagent

2808-1000 Biovision
EUR 990

MTS Reagent

2808-250 Biovision
EUR 365

MTT Reagent

2809-1G Biovision
EUR 180

MTT Reagent

2809-5G Biovision
EUR 544

Bradford reagent

BDE641 Bio Basic 100ml
EUR 61.01
  • Product category: Biochemicals/Biology Reagents/Protein Related

Polyclonal SCHIP1 Antibody (Center)

APR03745G Leading Biology 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SCHIP1 (Center). This antibody is tested and proven to work in the following applications:

Mouse SCHIP1 shRNA Plasmid

20-abx974064 Abbexa
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SCHIP1 ELISA KIT|Human

EF002743 Lifescience Market 96 Tests
EUR 689

Human SCHIP1 shRNA Plasmid

20-abx959308 Abbexa
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SCHIP1 Recombinant Protein (Human)

RP027742 ABM 100 ug Ask for price

SCHIP1 Recombinant Protein (Rat)

RP227642 ABM 100 ug Ask for price

SCHIP1 Recombinant Protein (Mouse)

RP170228 ABM 100 ug Ask for price

SCHIP1 Recombinant Protein (Mouse)

RP170231 ABM 100 ug Ask for price

SCHIP1 Recombinant Protein (Mouse)

RP170234 ABM 100 ug Ask for price

JM109-lysate Antibody

abx234439-100ug Abbexa 100 ug
EUR 551
  • Shipped within 5-12 working days.

BL21-lysate Antibody

abx230905-100ug Abbexa 100 ug
EUR 551
  • Shipped within 5-12 working days.

DH5a-lysate Antibody

abx232362-100ug Abbexa 100 ug
EUR 551
  • Shipped within 5-12 working days.

CMV Cell Lysate

35-1867 Fitzgerald 1 mg
EUR 1835
Description: CMV enriched cell lysate

HSV1 Cell Lysate

35-1872 Fitzgerald 1 ml
EUR 394
Description: HSV1 enriched cell lysate

HSV2 Cell Lysate

35-1873 Fitzgerald 1 ml
EUR 394
Description: HSV2 enriched cell lysate

Arabidopsis Thaliana Lysate

30R-AA023 Fitzgerald 150 ug
EUR 156
Description: Arabidopsis Thaliana Plant Lysate

Green Algae Lysate

PABL-1306 Alpha Diagnostics 50 ug
EUR 164

PhosphoBlocker Blocking Reagent

AKR-103 Cell Biolabs 1L
EUR 328
Description: Most commercially available Western blot blockers, such as dry milk or serum, are sufficient to block unreactive sites on the membrane. However, they are not designed to preserve phosphoprotein antigens during blotting. Our PhosphoBLOCKER Blocking Reagent provides superior blocking by maximizing signal-to-noise ratio. The PhosphoBLOCKER reagent particluarly excels with very low levels of endogenous phopsphoproteins.

PhosphoBlocker Blocking Reagent

AKR-104 Cell Biolabs 4L
EUR 711
Description: Most commercially available Western blot blockers, such as dry milk or serum, are sufficient to block unreactive sites on the membrane. However, they are not designed to preserve phosphoprotein antigens during blotting. Our PhosphoBLOCKER Blocking Reagent provides superior blocking by maximizing signal-to-noise ratio. The PhosphoBLOCKER reagent particluarly excels with very low levels of endogenous phopsphoproteins.

Biolipidure-1002-Reagent

Biolipidure-1002-10 Cusabio 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1002-Reagent is a synthetic amphoteric polymer that can be substituted for BSA in tubidimetric immunoassays. Biolipidure-1002 is an excellent blocker and also enhances assay sensitivity. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1002-Reagent

Biolipidure-1002-100 Biolipidure 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1002-Reagent is a synthetic amphoteric polymer that can be substituted for BSA in tubidimetric immunoassays. Biolipidure-1002 is an excellent blocker and also enhances assay sensitivity. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-103-Reagent

Biolipidure-103-10 Biolipidure 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-103-Reagent is a synthetic amphoteric polymer that can be substituted for BSA. It has been shown to enhance signals in rapid tests, western blots, and other similar immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-103-Reagent

Biolipidure-103-100 Biolipidure 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-103-Reagent is a synthetic amphoteric polymer that can be substituted for BSA. It has been shown to enhance signals in rapid tests, western blots, and other similar immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1201-Reagent

Biolipidure-1201-10 Biolipidure 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1201 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1201-Reagent

Biolipidure-1201-100 Biolipidure 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1201 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1301-Reagent

Biolipidure-1301-10 Biolipidure 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1301 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1301-Reagent

Biolipidure-1301-100 Biolipidure 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1301 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-203-Reagent

Biolipidure-203-10 Biolipidure 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-203 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-203 has been shown to enhance signal strength by improving signal-to-noise in ELISAs, EIAs, and related immunoassays. It also functions as an effective blocker and stabilizer in these assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-203-Reagent

Biolipidure-203-100 Biolipidure 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-203 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-203 has been shown to enhance signal strength by improving signal-to-noise in ELISAs, EIAs, and related immunoassays. It also functions as an effective blocker and stabilizer in these assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-206-Reagent

Biolipidure-206-10 Biolipidure 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-206 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-206 enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-206-Reagent

Biolipidure-206-100 Biolipidure 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-206 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-206 enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-405-Reagent

Biolipidure-405-10 Biolipidure 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-405 Reagent is a synthetic anionic polymer that can be used to enhance immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-405-Reagent

Biolipidure-405-100 Biolipidure 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-405 Reagent is a synthetic anionic polymer that can be used to enhance immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-502-Reagent

Biolipidure-502-10 Biolipidure 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-502 Reagent is a synthetic cationic polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-502-Reagent

Biolipidure-502-100 Biolipidure 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-502 Reagent is a synthetic cationic polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-702-Reagent

Biolipidure-702-10 Biolipidure 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-702 Reagent is a synthetic amphoteric polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-702-Reagent

Biolipidure-702-100 Biolipidure 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-702 Reagent is a synthetic amphoteric polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-802-Reagent

Biolipidure-802-10 Biolipidure 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-802 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-802 generally enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, Rapid-test, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-802-Reagent

Biolipidure-802-100 Biolipidure 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-802 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-802 generally enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, Rapid-test, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

BCA Reagent, 16ML

C144-16ML Arbor Assays 16ML
EUR 163

Alcohol, Reagent (70%)

EAS500 ScyTek Laboratories 500 ml
EUR 79

Alcohol, Reagent (70%)

EAS999 ScyTek Laboratories 1000 ml
EUR 101

Tri-RNA Reagent

FATRR-001 Favorgen 100ml
EUR 236

Tri-RNA Reagent

FATRR-002 Favorgen 50ml
EUR 176

Tri-RNA Reagent

FATRR-003 Favorgen 450ml
EUR 645

EL Transfection Reagent

20-abx098880 Abbexa
  • EUR 384.00
  • EUR 537.00
  • 0.75 ml
  • 1.5 ml
  • Shipped within 5-10 working days.

Mycoplasma Prevention Reagent

20-abx098886 Abbexa
  • EUR 425.00
  • EUR 509.00
  • 1 ml
  • 5 ml
  • Shipped within 5-10 working days.

Girard's reagent T

20-abx184099 Abbexa
  • EUR 203.00
  • EUR 314.00
  • 100 g
  • 500 g
  • Shipped within 1-2 weeks.

FcR blocking Reagent

20-abx290024 Abbexa
  • EUR 377.00
  • EUR 516.00
  • 200 tests
  • 400 tests
  • Shipped within 2-3 weeks.

Detection Reagent A

abx296004-120ul Abbexa 120 ul
EUR 321
  • Shipped within 5-10 working days.

Mycoplasma Prevention Reagent

20-abx298005 Abbexa
  • EUR 203.00
  • EUR 286.00
  • 1 ml
  • 5 ml
  • Shipped within 5-10 working days.

HAMA blocking reagent

85R-1001 Fitzgerald 1 gram
EUR 1974
Description: HAMA Blocking Reagent for use in immunoassays such as ELISA

HAMA blocking reagent

85R-1001P Fitzgerald 1 gram
EUR 2190
Description: HAMA Blocking Reagent for use in immunoassays such as ELISA

HAMA blocking reagent

85R-1003 Fitzgerald 1 gram
EUR 1974
Description: HAMA Blocking Reagent for use in immunoassays such as Rapid Tests

HAMA blocking reagent

85R-1014 Fitzgerald 50 mg
EUR 192
Description: HAMA blocking reagent for use in assays specific for clinical false positive samples

HAMA blocking reagent

85R-1025 Fitzgerald 50 mg
EUR 192
Description: HAMA blocking reagent for use in immunoassays

HAMA blocking reagent

85R-1026 Fitzgerald 50 mg
EUR 192
Description: HAMA blocking reagent for use in immunoassays

Convoy? Transfection Reagent

1110-1ml ACTGene
EUR 341

Bradford Dye Reagent

0209R AthenaES 100 ml
EUR 131

BSA (Reagent Grade)

30-AB79 Fitzgerald 1 kg
EUR 1552
Description: Reagent Grade Bovine Serum Albumin (99% pure)

BSA (Reagent Grade)

30-AB81 Fitzgerald 200 grams
EUR 476
Description: Reagent Grade Sulphydryl Blocked BSA (99% pure)

Griess Reagent Kit

30100 Biotium 1KIT
EUR 149
Description: Minimum order quantity: 1 unit of 1KIT

BODIPY-Acetylene Reagent

2594-1 Biovision
EUR 207

BODIPY-Acetylene Reagent

2594-5 Biovision
EUR 675

Biotin reagent (HRP)

65C-CE0202 Fitzgerald 5 mg
EUR 244
Description: HRP conjugated biotin labelling reagent

PureFection Transfection Reagent

LV750A-1 SBI 1 ml
EUR 359
  • Category: Lentiviral Technology

LP4K Transfection Reagent

LP4K GenTarget 1.0 ml / vial
EUR 304
Description: Lipid based transfection reagent for large plasmid and multiple plasmid transfection in both adhesive and suspenstion cell types.

HighGene transfection reagent

RM09014 Abclonal 1000μl
EUR 270

TissueDigest Reagent, 20X

T101 Insitus Biotechnologies 10ml
EUR 210

ExFect2000 Transfection Reagent

T202-01 Vazyme 0.5 ml
EUR 227

ExFect2000 Transfection Reagent

T202-02 Vazyme 1 ml
EUR 316

ExFect2000 Transfection Reagent

T202-03 Vazyme 5 ml
EUR 1052

Dissociation Reagent, 1ML

X017-1ML Arbor Assays 1ML
EUR 109

Dissociation Reagent, 25ML

X017-25ML Arbor Assays 25ML
EUR 258

Dissociation Reagent, 5ML

X017-5ML Arbor Assays 5ML
EUR 122

Dissociation Reagent, 1ML

X058-1ML Arbor Assays 1ML
EUR 73

Dissociation Reagent, 5ML

X058-5ML Arbor Assays 5ML
EUR 109

n-Heptane Reagent

HC5400 Bio Basic 1L
EUR 79
  • Product category: Biochemicals/Solvents

DTT (Cleland's reagent)

DB0058 Bio Basic 5g
EUR 84.8
  • Product category: Electrophoresis Related/Reducing Agents

DTNB (Ellman's Reagent)

DB0113 Bio Basic 5g
EUR 97.85
  • Product category: Biochemicals/Indicators/Stains/Peptide/Protein Related

Ethyl acetate Reagent

EC4600 Bio Basic 1L
EUR 79
  • Product category: Biochemicals/Solvents

SCHIP1 ORF Vector (Human) (pORF)

ORF009248 ABM 1.0 ug DNA
EUR 95

Schip1 ORF Vector (Mouse) (pORF)

ORF056744 ABM 1.0 ug DNA
EUR 506

Schip1 ORF Vector (Mouse) (pORF)

ORF056745 ABM 1.0 ug DNA
EUR 506

Schip1 ORF Vector (Mouse) (pORF)

ORF056746 ABM 1.0 ug DNA
EUR 506

Schip1 ORF Vector (Rat) (pORF)

ORF075882 ABM 1.0 ug DNA
EUR 506

IQCJ-SCHIP1 Recombinant Protein (Human)

RP065874 ABM 100 ug Ask for price

IQCJ-SCHIP1 Recombinant Protein (Mouse)

RP144110 ABM 100 ug Ask for price

SCHIP1 ELISA Kit (Human) (OKCA01504)

OKCA01504 Aviva Systems Biology 96 Wells
EUR 846
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 9.77 pg/mL

anti- BL21-lysate antibody

FNab00905 FN Test 100µg
EUR 585
Description: Antibody raised against BL21-lysate

anti- DH5a-lysate antibody

FNab02362 FN Test 100µg
EUR 585
  • Recommended dilution: WB: 1:1000-1:10000
  • Immunogen: Bacterial Lysates
Description: Antibody raised against DH5a-lysate

Human Lung Tumor lysate

HTL-1321 Alpha Diagnostics 1 mg
EUR 773

Human Brain Tumor lysate

HTL-1322 Alpha Diagnostics 1 mg
EUR 773

Human Breast Tumor lysate

HTL-1323 Alpha Diagnostics 1 mg
EUR 773

Human Kidney Tumor lysate

HTL-1324 Alpha Diagnostics 1 mg
EUR 773

Human Bladder Tumor lysate

HTL-1325 Alpha Diagnostics 1 mg
EUR 773

Human Cervix Tumor lysate

HTL-1326 Alpha Diagnostics 100ug
EUR 286

Human Duodenum Tumor lysate

HTL-1328 Alpha Diagnostics 1 mg
EUR 895

Human Esophagus tumor lysate

HTL-1329 Alpha Diagnostics 1 mg
EUR 773

Human Liver Tumor lysate

HTL-1330 Alpha Diagnostics 1 mg
EUR 773

Human Lymphoma Tumor lysate

HTL-1331 Alpha Diagnostics 1 mg
EUR 773

Human Ovary Tumor lysate

HTL-1333 Alpha Diagnostics 1 mg
EUR 773

Human Pancreas Tumor lysate

HTL-1334 Alpha Diagnostics 1 mg
EUR 773

Human Prostate Tumor lysate

HTL-1335 Alpha Diagnostics 1 mg
EUR 773

Human Rectum Tumor lysate

HTL-1336 Alpha Diagnostics 1 mg
EUR 773

Human Skin Tumor lysate

HTL-1337 Alpha Diagnostics 1 mg
EUR 773

Human Spleen Tumor lysate

HTL-1339 Alpha Diagnostics 1 mg
EUR 773

Human Stomach Tumor lysate

HTL-1340 Alpha Diagnostics 1 mg
EUR 773

Human Testis Tumor lysate

HTL-1381 Alpha Diagnostics 1 mg
EUR 773

Human Thymoma Tumor lysate

HTL-1382 Alpha Diagnostics 1 mg
EUR 773

Human Thyroid Tumor lysate

HTL-1383 Alpha Diagnostics 1 mg
EUR 773

Human Uterus Tumor lysate

HTL-1384 Alpha Diagnostics 1 mg
EUR 773

CHO Lysate Antigen Concentrate

F018H Cygnus Technologies 200 ul
EUR 604
  • Product category: Quality control/standard for molecular biology applications
Description: CHO Lysate Antigen Concentrate by Cygnus Technologies is available in Europe via Gentaur.

CHO Lysate Antigen Concentrate

F018R Cygnus Technologies 1 ml
EUR 6225
  • Product category: Quality control/standard for molecular biology applications
Description: CHO Lysate Antigen Concentrate by Cygnus Technologies is available in Europe via Gentaur.

anti- JM109-lysate antibody

FNab04439 FN Test 100µg
EUR 585
  • Immunogen: JM109-lysate
Description: Antibody raised against JM109-lysate

BL21(DE3)-lysate Antibody

abx230903-100ug Abbexa 100 ug
EUR 551
  • Shipped within 5-12 working days.

BL21(plysS) -lysate Antibody

abx230904-100ug Abbexa 100 ug
EUR 551
  • Shipped within 5-12 working days.

Human Brain Tissue Lysate

30R-AB017 Fitzgerald 150 ug
EUR 273
Description: Fresh tissue lysate isolated from human brain

Chicken Liver Tissue Lysate

30R-AC011 Fitzgerald 150 ug
EUR 192
Description: Freshly prepared tissue lysate isolated from liver of normal chicken

Human Cerebellum Tissue Lysate

30R-AC058 Fitzgerald 150 ug
EUR 290
Description: Freshly prepared tissue lysate isolated from cerebellum of human brain

Human Hippocampus Tissue Lysate

30R-AH Fitzgerald 150 ug
EUR 273
Description: Isolated Human Hippocampus Tissue Lysate

Human Heart Tissue Lysate

30R-AH049 Fitzgerald 150 ug
EUR 534
Description: Fresh tissue lysate isolated from human heart

Human Kidney Tissue Lysate

30R-AK003 Fitzgerald 150 ug
EUR 219
Description: Fresh tissue lysate isolated from human kidney

Rabbit Liver Tissue Lysate

30R-AL003 Fitzgerald 150 ug
EUR 252
Description: Fresh tissue lysate prepared from rabbit liver

Human Lung Tissue Lysate

30R-AL006 Fitzgerald 150 ug
EUR 219
Description: Fresh tissue lysate isolated from human lung

Human Midbrain Tissue Lysate

30R-AM011 Fitzgerald 150 ug
EUR 257
Description: Fresh tissue lysate isolated from the midbrain of human brain

Human Pancreas Tissue Lysate

30R-AP030 Fitzgerald 150 ug
EUR 219
Description: Fresh tissue lysate isolated from human pancreas

Human Prostate Tissue Lysate

30R-AP031 Fitzgerald 150 ug
EUR 219
Description: Fresh tissue lysate prepared from normal human prostate

Human Pons Tissue Lysate

30R-AP033 Fitzgerald 150 ug
EUR 235
Description: Fresh tissue lysate isolated from the pons of human brain

Human Posterior Cortex Lysate

30R-AP034 Fitzgerald 150 ug
EUR 235
Description: Fresh tissue lysate isolated from the posterior cortex of human brain

Rat Retina Tissue Lysate

30R-AR005 Fitzgerald 150 ug
EUR 267
Description: Fresh tissue lysate prepared from the retina of rat eye

Human Striatum Tissue Lysate

30R-AS030 Fitzgerald 150 ug
EUR 327
Description: Fresh tissue lysate isolated from the striatum of human brain

Human Stomach Tissue Lysate

30R-AS039 Fitzgerald 150 ug
EUR 219
Description: Fresh tissue lysate isolated from human stomach

Human Thalamus Tissue Lysate

30R-AT053 Fitzgerald 150 ug
EUR 235
Description: Fresh tissue lysate isolated from the thalamus of human brain

Jurkat cell Lysate (untreated)

2401-100 Biovision
EUR 185

JNK Activated Cell Lysate

7032-1 Biovision
EUR 316

Akt Activated Cell Lysate

7036-1 Biovision
EUR 316

Anti-BL21-lysate antibody

PAab00905 Lifescience Market 100 ug
EUR 412

Anti-DH5a-lysate antibody

PAab02362 Lifescience Market 100 ug
EUR 412

Anti-JM109-lysate antibody

PAab04439 Lifescience Market 100 ug
EUR 412

Rat Brain Tissue Lysate

LYSATE0002 BosterBio 200ug
EUR 150
Description: This cell lysate is prepared from Rat Brain Tissue using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.

Rat Liver Tissue Lysate

LYSATE0003 BosterBio 200ug
EUR 150
Description: This cell lysate is prepared from rat liver tissue using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.

Rat Lung Tissue Lysate

LYSATE0004 BosterBio 200ug
EUR 150
Description: This cell lysate is prepared from rat lung tissue using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.

Rat Testis Tissue Lysate

LYSATE0005 BosterBio 200ug
EUR 150
Description: This cell lysate is prepared from rat testis tissue using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.

Rat Kidney Tissue Lysate

LYSATE0006 BosterBio 200ug
EUR 150
Description: This cell lysate is prepared from rat kidney tissue using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.

Rat Spleen Tissue Lysate

LYSATE0007 BosterBio 200ug
EUR 150
Description: This cell lysate is prepared from rat spleen tissue using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.

Rat Thymus Tissue Lysate

LYSATE0008 BosterBio 200ug
EUR 150
Description: This cell lysate is prepared from rat thymus tissue using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.

Rat Heart Tissue Lysate

LYSATE0009 BosterBio 200ug
EUR 150
Description: This cell lysate is prepared from rat heart tissue using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.

Rat Ovary Tissue Lysate

LYSATE0011 BosterBio 200ug
EUR 150
Description: This cell lysate is prepared from rat ovary tissue using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.

Mouse Brain Tissue Lysate

LYSATE0012 BosterBio 200ug
EUR 150
Description: This cell lysate is prepared from mouse brain tissue using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.

Mouse Liver Tissue Lysate

LYSATE0013 BosterBio 200ug
EUR 150
Description: This cell lysate is prepared from mouse liver tissue using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.

Mouse Testis Tissue Lysate

LYSATE0014 BosterBio 200ug
EUR 150
Description: This cell lysate is prepared from mouse testis tissue using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.

Mouse Ovary Tissue Lysate

LYSATE0015 BosterBio 200ug
EUR 150
Description: This cell lysate is prepared from mouse ovary tissue using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.

Mouse Kidney Tissue Lysate

LYSATE0016 BosterBio 200ug
EUR 150
Description: This cell lysate is prepared from mouse kidney tissue using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.

Mouse Spleen Tissue Lysate

LYSATE0017 BosterBio 200ug
EUR 150
Description: This cell lysate is prepared from mouse spleen tissue using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.

Mouse Lung Tissue Lysate

LYSATE0018 BosterBio 200ug
EUR 150
Description: This cell lysate is prepared from mouse lung tissue using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.

Mouse Thymus Tissue Lysate

LYSATE0019 BosterBio 200ug
EUR 150
Description: This cell lysate is prepared from mouse thymus tissue using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.

Mouse Heart Tissue Lysate

LYSATE0020 BosterBio 200ug
EUR 150
Description: This cell lysate is prepared from mouse heart tissue using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.

Human Placenta Tissue Lysate

LYSATE0022 BosterBio 200ug
EUR 150
Description: This cell lysate is prepared from human placenta tissue using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.

Human U87 Cell Lysate

LYSATE0041 BosterBio 200ug
EUR 150
Description: This cell lysate is prepared from human U87 using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.

Trout Liver (Normal) Lysate

THUL-50 Alpha Diagnostics 50 ug
EUR 213

EZ Cap? Reagent AG

B8176-.01 ApexBio 10 µl (100 mM)
EUR 308
Description: EZ Cap Reagent AG is a co-transcriptional capping reagent for in vitro transcription of 5? capped mRNA which would result in a Cap 1 structure. Cap AG has shown to provide up to 98% capping efficiency in literatures.EZ Cap AG requires an AG initiator.
The current outcomes indicated that Microreader™ 23sp ID equipment included extremely polymorphic loci, and it might be effectively used for particular person identification, paternity testing, and inhabitants genetics in the Guanzhong Han inhabitants.
Categories Antibodies, Assay Kits, Biology Cells, Blog, cDNA, Clia Kits, Culture Cells, Devices, DNA, DNA Templates, DNA Testing, Elisa Kits, Enzymes, Equipments, Functional characterisation of metal(loid) processes in planta through the integration of synchrotron techniques and plant molecular biology., Test of Arabidopsis Space Transcriptome: A Discovery Environment to Explore Multiple Plant Biology Spaceflight Experiments. Tags particles crowded together, particles flow, particles for justice, particles gif, particles in urine, particles in urine female, particles in wood smoke, particles life, particles linguistics, particles list, particles lyrics, particles mod, particles of a liquid, particles of dark matter, particles of faith trasancos, particles particles, particles png, particles react npm, particles smaller than quark, particles synonym, particles.js, particleshop, particleshop corel, ria kista, ria kits run 2019, rna definition, rna fish, rna meaning, rna polymerase, rna primer, rna replication, rna reset, rna sequence, rna sequencing, rna splicing, rna structure, rna vaccine, rna vaccine wiki, rna velocity, rna viruses, rna vs dna, rna world, rna-seq, rnac, rnahybrid, rnai, rnascope, rnation login, rnation.riteaid.com, serums 101, serums 2019, serums 76, serums anoka menu, serums bar, serums def, serums fo76, serums for acne, serums for hair, serums for hair growth, serums for men, serums for sensitive skin, serums for wrinkles, serums in anoka, serums in anoka mn, serums mn, serums osrs, serums peru, serums ulta, serums vs creams, serums with glycerin, serums with spf, serums.com, serumstat, test kits cdc, test kits contaminated, test kits contaminated uk, test kits contaminated with coronavirus, test kits contaminated with covid-19, test kits contaminated with covid19, test kits fda, test kits for coronavirus, test kits for covid-19, test kits for ionizer systems, test kits for mdma, test kits for meth, test kits for mold, test kits for molly, test kits for nursing homes, test kits for ph, test kits for pools, test kits news, test kits ny, test kits usa, vector virus definition, vector virus example, vector virus introduction, vector virus relationship, victor virus, victor virus cartoonmania, virus, virus by state, virus by state numbers

About This Site

This may be a good place to introduce yourself and your site or include some credits.

Categories

  • Antibodies
  • Assay Kits
  • Bayesian approach for analysis of time-to-event data in plant biology.
  • Biology Cells
  • Blog
  • cDNA
  • Clia Kits
  • Culture Cells
  • Devices
  • DNA
  • DNA Templates
  • DNA Testing
  • Elisa Kits
  • Enzymes
  • Equipments
  • Functional characterisation of metal(loid) processes in planta through the integration of synchrotron techniques and plant molecular biology.
  • Test of Arabidopsis Space Transcriptome: A Discovery Environment to Explore Multiple Plant Biology Spaceflight Experiments.

Tags

Bayesian approach for analysis of time-to-event data in plant biology. dna templates google slides dna template synthesis dna template synthesis of polymers dna test for dogs Functional characterisation of metal(loid) processes in planta through the integration of synchrotron techniques and plant molecular biology. pcr pcram pcrb pcr covid test pcr covid testing pcrdfans pcre pcrfy pcrfy stock pcrichard&sons pcrichard.com pcrichard credit card pay bill pcrichard pay bill pcrichardsandsons pcr kits price pcrm pcr test for coronavirus pcr test for covid 19 pcr testing for covid-19 pcr tests pcr unit pcrx stock peptides and acids peptides anti-aging peptides collagen powder peptides definition peptides diet peptides for bodybuilding peptides for erectile dysfunction peptides for eyelash growth peptides for nerve repair peptides for sale peptides for skin peptides for weight loss peptides international peptides rodan and fields peptides serum peptides supplement Test of Arabidopsis Space Transcriptome: A Discovery Environment to Explore Multiple Plant Biology Spaceflight Experiments.
April 2021
M T W T F S S
 1234
567891011
12131415161718
19202122232425
2627282930  
« Mar    

Recent Posts

  • Viral infections in humans and mice with genetic deficiencies of the type I IFN response pathway
  • PHACTR1 genetic variability is not critical in small vessel ischemic disease patients and PcomA recruitment in C57BL/6J mice
  • Functional characterisation of metal(loid) processes in planta through the integration of synchrotron techniques and plant molecular biology.
  • Bayesian approach for analysis of time-to-event data in plant biology.
  • Test of Arabidopsis Space Transcriptome: A Discovery Environment to Explore Multiple Plant Biology Spaceflight Experiments.

Categories

  • Antibodies
  • Assay Kits
  • Bayesian approach for analysis of time-to-event data in plant biology.
  • Biology Cells
  • Blog
  • cDNA
  • Clia Kits
  • Culture Cells
  • Devices
  • DNA
  • DNA Templates
  • DNA Testing
  • Elisa Kits
  • Enzymes
  • Equipments
  • Functional characterisation of metal(loid) processes in planta through the integration of synchrotron techniques and plant molecular biology.
  • Test of Arabidopsis Space Transcriptome: A Discovery Environment to Explore Multiple Plant Biology Spaceflight Experiments.

Recent Posts

  • Viral infections in humans and mice with genetic deficiencies of the type I IFN response pathway
  • PHACTR1 genetic variability is not critical in small vessel ischemic disease patients and PcomA recruitment in C57BL/6J mice
  • Functional characterisation of metal(loid) processes in planta through the integration of synchrotron techniques and plant molecular biology.
  • Bayesian approach for analysis of time-to-event data in plant biology.
  • Test of Arabidopsis Space Transcriptome: A Discovery Environment to Explore Multiple Plant Biology Spaceflight Experiments.

Tags

Bayesian approach for analysis of time-to-event data in plant biology. dna templates google slides dna template synthesis dna template synthesis of polymers dna test for dogs Functional characterisation of metal(loid) processes in planta through the integration of synchrotron techniques and plant molecular biology. pcr pcram pcrb pcr covid test pcr covid testing pcrdfans pcre pcrfy pcrfy stock pcrichard&sons pcrichard.com pcrichard credit card pay bill pcrichard pay bill pcrichardsandsons pcr kits price pcrm pcr test for coronavirus pcr test for covid 19 pcr testing for covid-19 pcr tests pcr unit pcrx stock peptides and acids peptides anti-aging peptides collagen powder peptides definition peptides diet peptides for bodybuilding peptides for erectile dysfunction peptides for eyelash growth peptides for nerve repair peptides for sale peptides for skin peptides for weight loss peptides international peptides rodan and fields peptides serum peptides supplement Test of Arabidopsis Space Transcriptome: A Discovery Environment to Explore Multiple Plant Biology Spaceflight Experiments.
© 2021 Plant Biology • Built with GeneratePress